Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 4. SM-induced hCSF ferroptosis activates p38 MAPK signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Quantitative RT-PCR, Standard Deviation

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 6. Inhibiting p38 MAPK prevented mustard gas induced hCSF ferroptosis. The hCSF were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas. (A) Representative Western blot images. SB202190 significantly inhibited p38 MAPK phosphorylation (B) at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The inhibi- tion of pp38 MAPK in hCSF significantly promoted cell viability (C) after mustard gas exposure at eight hours (P < 0.01) and 24 hours (P < 0.01). The addition of (+) shows treatment added to culture media. Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. (Blue Bars = addition of SB202190 and Red = without SB202190.) (** P < 0.05; *** P < 0.001; **** P < 0.0001)

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Activity Assay, Western Blot, Phospho-proteomics, Standard Deviation

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 5. The p38 MAPK activation correlates with mustard gas induced ferroptosis. hCSFs exposed to mustard gas were subjected to live/dead assay for cell death and to western blotting to test phos- phorylated p38 MAPK to p38 MAPK ratio (pp38/p38). Cell death (A) significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). Panel B shows represen- tative Western blot images. The pp38/p38 MAPK ratio significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The p38 MAPK activation had a direct time- dependent increase with ferroptosis in hCSF. Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. *** P < 0.001; **** P < 0.0001

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Activation Assay, Live Dead Assay, Western Blot, Standard Deviation

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 7. Inhibition of p38 MAPK in hCSF significantly reduced mustard gas–induced ROS production. The hCSFs were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas for 24 hours. The inhibition of pp38 MAPK in hCSF significantly reduced ROS production after mustard gas exposure (P < 0.05). Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Inhibition, Activity Assay, Standard Deviation